View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11619_high_28 (Length: 244)
Name: NF11619_high_28
Description: NF11619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11619_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 27327288 - 27327054
Alignment:
| Q |
1 |
atgatgcattgtcccatatggtcaaaacaaaggagcaaagtnnnnnnnnnnnnnnnngtaataaaagtgcaagaagaatgatatacctaaacccaggggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27327288 |
atgatgcattgtcccatatggtcaaaacaaaggagcaaagtaaaaaactaaaaaaa-gtaataaaagtgcaagaagaatgatatacctaaacccaggggg |
27327190 |
T |
|
| Q |
101 |
cttggaaggagcatcaaattgaggatgaacataacatttgagataatctctccaatagagggttttgtctaccttcaaattaaagcttgtaccacatcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27327189 |
cttggaaggagcatcaaattgaggatgaacataacatttgagataatctctccaatagagggttttgtctaccttcaaattaaagcttgtaccacatcta |
27327090 |
T |
|
| Q |
201 |
attggatcaaatagcttttcacttatgtactccttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27327089 |
attggatcaaatagcttttcacttatgtactccttt |
27327054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University