View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11619_low_25 (Length: 262)
Name: NF11619_low_25
Description: NF11619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11619_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 53940280 - 53940184
Alignment:
| Q |
1 |
gagaatttggctttagatactctcgtcaacttgtttaaagataattaacaaaagattagtgatattttaacaaccaattgagacaaccttgatgaca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53940280 |
gagaatttggctttagatactctcgtcaacttgtttaaagataatttacaaaagattagtgatattttaacaactaattgagacaaccttgatgaca |
53940184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 173 - 246
Target Start/End: Complemental strand, 53940108 - 53940035
Alignment:
| Q |
173 |
ttatcataaagtggttgtataaatataattttttccctttacaaaattataattttagttaccatggttgtatt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53940108 |
ttatcataaagtggttgtataaatataattttttctctttacaaaattataattttagttaccatggttgtatt |
53940035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 39241184 - 39241224
Alignment:
| Q |
47 |
aacaaaagattagtgatattttaacaaccaattgagacaac |
87 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
39241184 |
aacaaaagagtagtgatattttaacaaccatttgagacaac |
39241224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 173 - 206
Target Start/End: Original strand, 32510871 - 32510904
Alignment:
| Q |
173 |
ttatcataaagtggttgtataaatataatttttt |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
32510871 |
ttatcataaattggttgtataaatataatttttt |
32510904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University