View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11619_low_27 (Length: 252)

Name: NF11619_low_27
Description: NF11619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11619_low_27
NF11619_low_27
[»] chr8 (3 HSPs)
chr8 (105-249)||(31427930-31428074)
chr8 (107-249)||(31432902-31433044)
chr8 (116-249)||(31443818-31443951)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 105 - 249
Target Start/End: Original strand, 31427930 - 31428074
Alignment:
105 aaaatggcgaatacaaacttatcttgcttgatactatgtttactacctctctttcttgtagccaaagcagagcaatgtgatagtcatgttgatggagctg 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| | | ||||||||     
31427930 aaaatggcgaatacaaacttatcttgcttgatactatgtttactacctctctttcttgtagccaaagctgagcaatgtggtagtcaagctaatggagctc 31428029  T
205 tttgcccaaatgggatgtgttgcagcaaatttggttcttgtggca 249  Q
    |||||||||||||| | ||||||||||||||||||| ||||||||    
31428030 tttgcccaaatgggctatgttgcagcaaatttggtttttgtggca 31428074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 107 - 249
Target Start/End: Original strand, 31432902 - 31433044
Alignment:
107 aatggcgaatacaaacttatcttgcttgatactatgtttactacctctctttcttgtagccaaagcagagcaatgtgatagtcatgttgatggagctgtt 206  Q
    |||||| | |||||| ||||||||||||||||||||||| |||||||||||||||| | | |||||||| ||||||| |||||| | | || ||||||||    
31432902 aatggcaagtacaaaattatcttgcttgatactatgtttgctacctctctttcttggatcaaaagcagaacaatgtggtagtcaagctaatagagctgtt 31433001  T
207 tgcccaaatgggatgtgttgcagcaaatttggttcttgtggca 249  Q
    || ||||||||| | ||||| |||||||||||||  |||||||    
31433002 tgtccaaatgggctatgttgtagcaaatttggttggtgtggca 31433044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 116 - 249
Target Start/End: Original strand, 31443818 - 31443951
Alignment:
116 tacaaacttatcttgcttgatactatgtttactacctctctttcttgtagccaaagcagagcaatgtgatagtcatgttgatggagctgtttgcccaaat 215  Q
    |||||| ||||||||||||||||||||||||||| || ||||||||| | |||||||  ||||||||| ||| || | | |||||||||||||  | |||    
31443818 tacaaaattatcttgcttgatactatgtttactagctttctttcttggatccaaagctcagcaatgtggtagacaagctaatggagctgtttgtgcgaat 31443917  T
216 gggatgtgttgcagcaaatttggttcttgtggca 249  Q
     || | ||||||||| ||||||||| ||||||||    
31443918 aggctatgttgcagccaatttggttattgtggca 31443951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University