View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11619_low_29 (Length: 241)
Name: NF11619_low_29
Description: NF11619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11619_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 31 - 232
Target Start/End: Complemental strand, 36457751 - 36457550
Alignment:
| Q |
31 |
ccctttttaatggcatggatgttattgccattttattaactccattctttgcttgttcaagttctaatgctcggatatggaaagctaccgtggatggttc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36457751 |
ccctttttaatggcatggatgttattgccattttatcaactccattctttgcttgttcaagttctaatgctcggatatggaaagctaccgtggattgttc |
36457652 |
T |
 |
| Q |
131 |
atgtaccgttaaatatgatgttcagatatggaaagcttgttgttgacccaatccgcaataatatgagctagaacactattagaagcgtgagaatacctcc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457651 |
atgtaccgttaaatatgatgttcagatatgaaaagcttgttgttgacccaatccgcaataatatgagctagaacactattagaagcgtgagaatacctcc |
36457552 |
T |
 |
| Q |
231 |
ta |
232 |
Q |
| |
|
|| |
|
|
| T |
36457551 |
ta |
36457550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University