View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11620_low_4 (Length: 383)
Name: NF11620_low_4
Description: NF11620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11620_low_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 70 - 383
Target Start/End: Original strand, 46894746 - 46895059
Alignment:
| Q |
70 |
ccatgttggtgtgtatagaaagatgtgttgagttgatcaagttagtgaattacactatatatagagagggaccgtttttaataagcggcagagattgtga |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894746 |
ccatgttggtgtgtatagaaagatgtgttgagttgatcaagttagtgaattacactatatatagagagggaccgtttttaataagcggcagagattgtga |
46894845 |
T |
|
| Q |
170 |
cattattttggaagtgtttgatggttatgaatttccagaataatgttgggatggattgatgaacttgagattaataagaaaacaaactggtggtgagtgt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894846 |
cattattttggaagtgtttgatggttatgaatttccagaataatgttgggatggattgatgaacttgagattaataagaaaacaaactggtggtgagtgt |
46894945 |
T |
|
| Q |
270 |
gaggggttgagggttacttggcagctaagaggaaaagcttagttgcatggtgtgcagttttcatttgttttatgtaatgtaaaggaaacgtgtggagttt |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894946 |
gaggggttgagggttacttggcagctaagaggaaaagcttagttgcatggtgtgcagttttcatttgttttatgtaatgtaaaggaaacgtgtggagttt |
46895045 |
T |
|
| Q |
370 |
gtgcatttttgcat |
383 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46895046 |
gtgcatttttgcat |
46895059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University