View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11621_high_14 (Length: 414)
Name: NF11621_high_14
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11621_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 215 - 406
Target Start/End: Original strand, 31632575 - 31632766
Alignment:
| Q |
215 |
atagaagaggcttttagtttgtctcctttttcaacagagggatatttgaaagaggcagtctctttgagtaggcaaatgggatgttttgtaccttaacact |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31632575 |
atagaagaggcttttagtttgtctcctttttcaacagagggatatttgaaagaggcagtctctttgagtaggcaaatgggatgttttgtaccttaacact |
31632674 |
T |
|
| Q |
315 |
gcaacttataaatatacttttcaaaagcttagatataccataacacccaaaacctgacagacactatacctcctttggttaatccctatgct |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31632675 |
gcaacttataaatatacttttcaaaagcttggatataccataacacccaaaacctgacagacactatacctcctttggttaatccctatgct |
31632766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 19 - 170
Target Start/End: Original strand, 31632355 - 31632506
Alignment:
| Q |
19 |
atcacagtcttatttagggagtggacggtgttgtgaggatttgcagctgaaggaaaaagtgaagcaatgacaaggaaaagaaagcttaggcaattattag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31632355 |
atcacagtcttatttagggagtggacggtgttgtgaggatttgcagctgaaggaaaaagtgaagcaatgacaaggaaaagaaagcttaggcaattattag |
31632454 |
T |
|
| Q |
119 |
cattggagatgagattccctagtggaagatgacatatacaagaatgttgaca |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31632455 |
cattggagatgagattccctagtggaagatgacatatacaagaatgttgaca |
31632506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University