View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11621_high_24 (Length: 280)
Name: NF11621_high_24
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11621_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 5997023 - 5996920
Alignment:
| Q |
18 |
gaagataatacgctctatctttgagttcattcgaactgtaagtgccaaaattgtcgatagatatttgatgtcataccgtaaagttttaagtttgatgtaa |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5997023 |
gaagataatacgctcaatctttgagttcattcgaattgtaagtgccaaaattgtcggtagatatttgatgtcataccgtaaagttttaagtttgatgtaa |
5996924 |
T |
 |
| Q |
118 |
tgtt |
121 |
Q |
| |
|
|||| |
|
|
| T |
5996923 |
tgtt |
5996920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 179 - 245
Target Start/End: Complemental strand, 5996918 - 5996850
Alignment:
| Q |
179 |
ttaaacggtggttttgacttagagatatctagacatgcagttttatgtcatc--tgtgcatttaaatta |
245 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5996918 |
ttaaacggtgtttttgacttagagatatctagacatgcagttttatgtcatcgttgtgcatttaaatta |
5996850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University