View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11621_high_24 (Length: 280)

Name: NF11621_high_24
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11621_high_24
NF11621_high_24
[»] chr5 (2 HSPs)
chr5 (18-121)||(5996920-5997023)
chr5 (179-245)||(5996850-5996918)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 5997023 - 5996920
Alignment:
18 gaagataatacgctctatctttgagttcattcgaactgtaagtgccaaaattgtcgatagatatttgatgtcataccgtaaagttttaagtttgatgtaa 117  Q
    ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
5997023 gaagataatacgctcaatctttgagttcattcgaattgtaagtgccaaaattgtcggtagatatttgatgtcataccgtaaagttttaagtttgatgtaa 5996924  T
118 tgtt 121  Q
    ||||    
5996923 tgtt 5996920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 179 - 245
Target Start/End: Complemental strand, 5996918 - 5996850
Alignment:
179 ttaaacggtggttttgacttagagatatctagacatgcagttttatgtcatc--tgtgcatttaaatta 245  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||    
5996918 ttaaacggtgtttttgacttagagatatctagacatgcagttttatgtcatcgttgtgcatttaaatta 5996850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University