View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11621_high_26 (Length: 273)
Name: NF11621_high_26
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11621_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 8e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 52119256 - 52119167
Alignment:
| Q |
1 |
atccggttcgatgctttgttttggaacctgaaaattgtactataaccttttaaaatatatattgacacttattttgctgatgcccttcaacc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
52119256 |
atccggttcgatgctttgttttggaacctgaaaattgtactataaccttttaaaat--atattgacacttattttgctgatgtccttcaacc |
52119167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 84 - 169
Target Start/End: Complemental strand, 52116823 - 52116738
Alignment:
| Q |
84 |
ccttcaacccaaatgaattgacattgtaggataggataataatccaaaacaattcctaatgtaccacaaatctgaaaatcgtaagg |
169 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
52116823 |
ccttcaacccaaatgaattaacattgtaggatgggataataatccaaaacaattcctaatttaccacaaatctaaaaatcgtaagg |
52116738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 199 - 249
Target Start/End: Complemental strand, 52116709 - 52116659
Alignment:
| Q |
199 |
tacagatagaatcattttatttttctctttgtaatcccttgatcatctcag |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52116709 |
tacagatagaatcattttatttttctctttgtaatcccttgatcatctcag |
52116659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University