View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11621_low_13 (Length: 436)
Name: NF11621_low_13
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11621_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 11 - 64
Target Start/End: Complemental strand, 42301329 - 42301277
Alignment:
| Q |
11 |
aagaataatggggaaaaagaaggggggatttatttatttaaaaattccaattta |
64 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42301329 |
aagaataatggggaaaaagaaggggg-atttatttatttaaaaattccaattta |
42301277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University