View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11621_low_13 (Length: 436)

Name: NF11621_low_13
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11621_low_13
NF11621_low_13
[»] chr5 (1 HSPs)
chr5 (11-64)||(42301277-42301329)


Alignment Details
Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 11 - 64
Target Start/End: Complemental strand, 42301329 - 42301277
Alignment:
11 aagaataatggggaaaaagaaggggggatttatttatttaaaaattccaattta 64  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||    
42301329 aagaataatggggaaaaagaaggggg-atttatttatttaaaaattccaattta 42301277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University