View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11621_low_33 (Length: 241)
Name: NF11621_low_33
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11621_low_33 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 7 - 241
Target Start/End: Original strand, 13411531 - 13411765
Alignment:
| Q |
7 |
ttttcttcttgtttcactgagaaagattctgaattagtaaacatggtttccatttctgaacttgtagaggtagaataatgctgctgctgatgattctcat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13411531 |
ttttcttcttgtttcactgagaaagattctgaattagtaaacattgtttccatttctgaacttgtagaggtagaataatgctgctgctgatgattctcat |
13411630 |
T |
 |
| Q |
107 |
ttctgaaagtttcttcattgaaaaatccaatgcttctgtctacaaggcttgtaagtaatgagcttggagctgaacaataccgcgttaagccggaattgtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13411631 |
ttctgaaagtttcttcattgaaaaatccaatgcttctgtctacaaggcttgtaagtaatgagcttggagctgaacgataccgcgttaagccggaattgtt |
13411730 |
T |
 |
| Q |
207 |
ttggagacaatgttgttgtgtttgtgagtaaccaa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13411731 |
ttggagacaatgttgttgtgtttgtgagtaaccaa |
13411765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University