View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11621_low_35 (Length: 239)
Name: NF11621_low_35
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11621_low_35 |
 |  |
|
| [»] scaffold0699 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0699 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: scaffold0699
Description:
Target: scaffold0699; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 130 - 224
Target Start/End: Original strand, 2078 - 2168
Alignment:
| Q |
130 |
tagccgaataggagaaagattgtgagcagacccgcaaccaactaagctcagacaaattcacgatatttatttacacacactatcaatgtcaaata |
224 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2078 |
tagccgaataggagaaaggttgtgagcagacccgcaaccaactaagctcagacaaattcacga----tatttacacacactatcaatgtcaaata |
2168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University