View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11621_low_39 (Length: 213)
Name: NF11621_low_39
Description: NF11621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11621_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 2747488 - 2747675
Alignment:
| Q |
12 |
gagatgaaccaggcgagaacgcatttgggtcgggtttcatgtaatgcgggtcaataacaaaaagagggtacagattagaacaccctcgtgtagcgtattc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2747488 |
gagatgaaccaggcgagaacgcatttgggtcgggtttcatgtaatgcggatcaataacaaaaagagggtacagattagaacaccctcgtgtggcgtattc |
2747587 |
T |
|
| Q |
112 |
tagtgccgggttatcgtggatccgaataccctttcgaaaccatatcatagaacccgacccgagtgtcattgaagaagaagaagttaat |
199 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2747588 |
tagtgctgggttatcgtggatccgaatgccctttcgaaaccatatcatagaacccgacccgagtgtcattgaagaagaagaagttaat |
2747675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University