View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_high_26 (Length: 324)
Name: NF11622_high_26
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 308
Target Start/End: Complemental strand, 42307091 - 42306802
Alignment:
| Q |
19 |
ggtattttgttttacgttattataatgatacttggtaattataggcaaaggcagtatcatcataattaaagttcttattttcttgccaaattcaggatat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42307091 |
ggtattttgttttacgttattataatgatacttggtaattataggcaaaggcagtatcatcataattaaagttcttattttcttgccaaattcaggatat |
42306992 |
T |
 |
| Q |
119 |
aagcatgannnnnnnncgttttggaggggatgggttggggccaggtagcttccaatcccctcatggattatgaatggcataacgtgaacatcatagttga |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42306991 |
aagcatgattttttttcgttttggaggggatgggttggggccaggtagcttccaatcccctcatggattatgagtggcataacgtgaacatcatagttga |
42306892 |
T |
 |
| Q |
219 |
cacatggaattttggatgtgcctaacttccttataggaatcaaatgtcaattagctggtcatggggttacctttggtgtagcttgttcat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306891 |
cacatggaattttggatgtgcctaacttccttataggaatcaaatgtcaattagctggtcatggggttacctttggtgtagcttgttcat |
42306802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 96 - 293
Target Start/End: Complemental strand, 16935946 - 16935751
Alignment:
| Q |
96 |
ttttcttgccaaattcaggatataagcatgannnnnnnncgttttggaggggatgggttggggccaggtagcttccaatcccctcatggattatgaatgg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16935946 |
ttttcttgccaaattcaggatataagcatgattttt---cttcttggaggggatgggttggggccaggtagcttccaatcccctcatggattatgagtgg |
16935850 |
T |
 |
| Q |
196 |
cataacgtgaacatcatagttgacacatggaattttggatgtgcctaacttccttataggaatcaaa-tgtcaattagctggtcatggggttacctttg |
293 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||| | ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16935849 |
cataacgtgaacatcatggttgacacatggaattttggatgtgcctaatttccttatgggactgaaattgtcaattagctggtcatggggttacatttg |
16935751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University