View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_high_40 (Length: 255)
Name: NF11622_high_40
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_high_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 29942615 - 29942852
Alignment:
| Q |
18 |
gatatatatgtctctgttgttttttaattactgcccccatatatggaattgttatcttgggnnnnnnnnnnnnnactcaacgtttctctttgttcttctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29942615 |
gatatatatgtctctgttgttttttaattactgcccccatatatggaattgttatcttgggtttttacttttttactcaacgtttctctttgttcttctt |
29942714 |
T |
 |
| Q |
118 |
gttttgacgatagtaattgcttgagtacaaacaagtttttaaacttaggtcaatttgacagtccatactgcatcatgttttctgtgacttttgcatgcat |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29942715 |
gtttggacgatagtaattgcttgagtacaaacaagtttttaaacttaggtcaatttgacagtccatactgcatcatgttttctgtgacttttgcatgcat |
29942814 |
T |
 |
| Q |
218 |
tcatagttcatttatatcaaatttattatgttctttgt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29942815 |
tcatagttcatttatatcaaatttattatgttctttgt |
29942852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University