View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_high_42 (Length: 246)
Name: NF11622_high_42
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_high_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 24 - 236
Target Start/End: Complemental strand, 38991202 - 38990990
Alignment:
| Q |
24 |
gtcatgaagctgacatcacagtgctgagaggttctggtattgtctctgacatcaccattcacaactcgttatcccataccccaccactcactattgaagg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38991202 |
gtcatgaagctgacatcacagtgctgagaggttttggtattgtctctgacatcaccattcacagctcgttatctcataccccaccactcactattgaagg |
38991103 |
T |
|
| Q |
124 |
acctgtccaaatgacgtctctctctggcacttatgtcaatcccaatgttgataatgttccttctgaagtcattgccaaccctgcatgttcttcttttagc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38991102 |
acctgtccaaatgacgtctctctctggcacttatgtcaatcccaatgttgataatgttccttctgaagtcattgccaaccctgcatgttcttcttttagc |
38991003 |
T |
|
| Q |
224 |
attttcctctctg |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38991002 |
attttcctctctg |
38990990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 24 - 236
Target Start/End: Original strand, 38954573 - 38954785
Alignment:
| Q |
24 |
gtcatgaagctgacatcacagtgctgagaggttctggtattgtctctgacatcaccattcacaactcgttatcccataccccaccactcactattgaagg |
123 |
Q |
| |
|
||||| ||||||| ||| |||| |||||||||| ||| |||||||| | || ||||| | |||||| ||| ||| |||| |||| ||||||||||| |
|
|
| T |
38954573 |
gtcatcaagctgatatctcagtaatgagaggttccggtcttgtctctaatattaccatccgtaactcgacatctcattcccctgcactaactattgaagg |
38954672 |
T |
|
| Q |
124 |
acctgtccaaatgacgtctctctctggcacttatgtcaatcccaatgttgataatgttccttctgaagtcattgccaaccctgcatgttcttcttttagc |
223 |
Q |
| |
|
||| || |||||| |||||||||||||||||| ||||||||||| ||||| ||||||||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
38954673 |
acccatcaaaatgatgtctctctctggcacttacatcaatcccaattctgatactgttccttctgaattcatcaccaaccctaaccattcttcttttagc |
38954772 |
T |
|
| Q |
224 |
attttcctctctg |
236 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
38954773 |
attttcctatctg |
38954785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University