View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_11 (Length: 461)
Name: NF11622_low_11
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 25544176 - 25544053
Alignment:
| Q |
1 |
catctttgagatatgaagctagacaacggtctaattcaaaggagatcttgctaatattgt-nnnnnnnnnntctctgcttagtatg-tttgcatttccaa |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
25544176 |
catcttcgagatatgaagctagacaacggtctaattcaaaggagatcttgctaatattgtaaaaaaaaaaacctctgcttagtatgttttgcatttccaa |
25544077 |
T |
 |
| Q |
99 |
aacgacaatattcgatttcgacaa |
122 |
Q |
| |
|
||||||||| || ||||||||||| |
|
|
| T |
25544076 |
aacgacaatctttgatttcgacaa |
25544053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 25544056 - 25544018
Alignment:
| Q |
163 |
acaagctcatataacatgaacgaatcgtagttggataga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25544056 |
acaagctcatataacatgaacgaatcgtagtcggataga |
25544018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University