View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_28 (Length: 323)
Name: NF11622_low_28
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_28 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 161 - 323
Target Start/End: Complemental strand, 34556209 - 34556047
Alignment:
| Q |
161 |
agcatgtgggttccatgctaaaacatgaatcttttgtaagtgttgatctccgggcctgactgactaactttattgagatgtggttctgagcttcagacca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34556209 |
agcatgtgggttccatgctaaaacatgaatcttttgtaagtgttgatctccgggcctgactgactaactttattgagatgtggttctgagcttcagacca |
34556110 |
T |
 |
| Q |
261 |
ctcttcagaggatgtctagtttacttctctgtttcatgtcagcatatccattttctagggttc |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34556109 |
ctcttcagaggatgtctagtttacttctctgtttcatgtcagcatatccattttctagggttc |
34556047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 31 - 127
Target Start/End: Complemental strand, 34556340 - 34556244
Alignment:
| Q |
31 |
actggagggcatggtgattggttcttttccatgttccctttctagggattcttctcatttccctatgaatgaattttgaaaatatctttttgggctt |
127 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34556340 |
actggagcgcatggtgattggttcttttccatgttccctttatagggattcttctcatttccctatgaatgaattttgaaaatatctttttgggctt |
34556244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University