View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_29 (Length: 316)
Name: NF11622_low_29
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 8 - 301
Target Start/End: Original strand, 31033191 - 31033484
Alignment:
| Q |
8 |
aaaaatttagaattgacatcaacttcctttaaccaatctattctaagttttttgcgactgaatacctgaatgcaatttgaataaagttgtttcatctgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31033191 |
aaaaatttagaattgacatcaacttcctttaaccaatctattctaagttttttgcgactgaatacctgaatgcaatttgaataaagttgtttcatctgct |
31033290 |
T |
 |
| Q |
108 |
gataaagaatgaagctcttccatctcctccgcttgaatcatttgcannnnnnntttaatatccaagaaagacatacaatctttaaccaaccgaattcttc |
207 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
31033291 |
gataaagaatgaaactcttccatctcatccgcttgaatcatttgcacctcccctttaatatccaagaaagacatacgatctttaaccaaccgaattctac |
31033390 |
T |
 |
| Q |
208 |
cttctatgttttgggtatggctttgatgccaactcttcagacatcccttatcagtttaaatttctctttcaacacataaccactccacccatgt |
301 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31033391 |
cttctaagttttgggtatggttttgatgccaactcttcagacatcccttatcagtttaaatttctctttcaacacataaccactccacccatgt |
31033484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University