View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_38 (Length: 268)
Name: NF11622_low_38
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 5 - 252
Target Start/End: Original strand, 6364185 - 6364431
Alignment:
| Q |
5 |
agaagcataggcagagtaaacatttgtatcaacaaaaagacttagtaaacaacatcagggataaaaacattagttgtcaagtagaatacaatttcacatt |
104 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6364185 |
agaatcataagcagagtaaacatttgtatcaacaaaaagacttagtaaacaacatcagggataaaaacattagttgtcaagtagaatacaatttcacatt |
6364284 |
T |
|
| Q |
105 |
ttagtaccatatcacttaatttttgccagaatttcttaaaatataacatactcaagtgttaagatagaacataaagtttataacctttacgagctgcttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
6364285 |
ttagtaccatatcacttaatttttgccagaatttcttaaaatataacatactcaagtgttaagatagaacgtaaag-ttataacctttacgagctgcttt |
6364383 |
T |
|
| Q |
205 |
cctgccggttctccctcttcgagggtaagggagggtgctagatcctcc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6364384 |
cctgccggttctccctcttcgagggtaagggagggtgctagatcctcc |
6364431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 183 - 252
Target Start/End: Original strand, 6275645 - 6275714
Alignment:
| Q |
183 |
tataacctttacgagctgctttcctgccggttctccctcttcgagggtaagggagggtgctagatcctcc |
252 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||| | |||| | |||||||| |
|
|
| T |
6275645 |
tataacctttcttagctggtttcctgccggttctccctcttcgagggtaaggcaaggtgttggatcctcc |
6275714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 6333053 - 6333124
Alignment:
| Q |
163 |
ttaagatagaacataaagtttataacctttacgagctgctttcctgccggttctccctcttcgagggtaagg |
234 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
6333053 |
ttaagatagagcataaagtttatcaccttttttagcatgtttcctgccggttctcccccttcgagggtaagg |
6333124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 6290391 - 6290450
Alignment:
| Q |
177 |
aaagtttataacctttacgagctgctttcctgccggttctccctcttcgagggtaaggga |
236 |
Q |
| |
|
|||||||||||||||| ||||| || |||||||||||| || |||||||||||||||| |
|
|
| T |
6290391 |
aaagtttataacctttcttagctggttccctgccggttcttccccttcgagggtaaggga |
6290450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6322505 - 6322557
Alignment:
| Q |
182 |
ttataacctttacgagctgctttcctgccggttctccctcttcgagggtaagg |
234 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
6322505 |
ttataaccttttttagctggtttcctgccggttctgccccttcgagggtaagg |
6322557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 252
Target Start/End: Original strand, 6425192 - 6425248
Alignment:
| Q |
196 |
agctgctttcctgccggttctccctcttcgagggtaagggagggtgctagatcctcc |
252 |
Q |
| |
|
||||| ||| ||||| |||||||| |||||||||||||| | |||||| |||||||| |
|
|
| T |
6425192 |
agctggttttctgcctgttctcccccttcgagggtaaggcaaggtgctcgatcctcc |
6425248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University