View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_40 (Length: 264)
Name: NF11622_low_40
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_40 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0004 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 6 - 230
Target Start/End: Original strand, 81288 - 81511
Alignment:
| Q |
6 |
acttgctttgacgtctgatgcttataaaggtataatcnnnnnnnnnnnntattcacatcaaaatcttctatctccttcatctataaatagatataaatat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
81288 |
acttgctttgacgtctgatgcttataaaggtataatcaaaaaagaaaa-tattcacatcaaaatcttctatcttcttcatctataaatagatataaatat |
81386 |
T |
 |
| Q |
106 |
agataaagaaaaattgcaaaatatcacttgagtgatgaatgtggcaactacaaaatagattgtaaatcggtattgaaggtgatttttcatcatcaaatgc |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
81387 |
agataaaaaaaaattgcaaaatatcacttgagtgatgaatgtggcaactacaaaataggttgtaagtcggtattgaaggtgatttttcatcatcaaacgc |
81486 |
T |
 |
| Q |
206 |
taaacaccgaccaaagattcaagat |
230 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
81487 |
taaacactgaccaaagattcaagat |
81511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University