View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_41 (Length: 255)
Name: NF11622_low_41
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 34556057 - 34555819
Alignment:
| Q |
1 |
ttctagggttcttttcttcttctgatttcactctcaactacacttacctccctcatgtaggatttgtaagcatcttacataaacaaatggaatctggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34556057 |
ttctagggttcttttcttcttctgatttcactctcaactacacttacctccctcatgtaggatttgtaagcatcttacataaacaaatggaatctggtgg |
34555958 |
T |
|
| Q |
101 |
tagattctactcagttgatgagttcaatttagaccctaaatggttggttgatcctaaacatctttatgttgggcccaggattggtgaaggagctcatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34555957 |
tagattctactcagttgatgagttcaatttagaccctaaatggttggttgatcctaaacatctttatgttgggcccaggattggtgaaggagctcatgct |
34555858 |
T |
|
| Q |
201 |
aaagtctacgagggaaagtaagtttcttaaattgctttt |
239 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34555857 |
aaagtctatgagggaaagtaagtttcttaaattgctttt |
34555819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 281560 - 281603
Alignment:
| Q |
180 |
attggtgaaggagctcatgctaaagtctacgagggaaagtaagt |
223 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||||||||||| |
|
|
| T |
281560 |
attggtgaaggtgctcatgctaaagtctatgaaggaaagtaagt |
281603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University