View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_43 (Length: 250)
Name: NF11622_low_43
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 230
Target Start/End: Original strand, 49756606 - 49756821
Alignment:
| Q |
15 |
cacagaggagctggcattgaggtttgttggtttcacattatgatgatttcatatatgcatgcagtaatgtttgtggatggagatgaatttatttattaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49756606 |
cacagaggagctggcattgaggtttgttggtttcacattatgatgatttcatatatgcatgcagtaatgtttgtggatggagatgaatttatttattaaa |
49756705 |
T |
|
| Q |
115 |
agagtttgaacttaataattgttaggtgaggattgccagaatctttaacacatacggaccaagaatgtgcattgatgatgggcgtgtggtcagtaacttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49756706 |
agagtttgaacttaataattgttaggtgaggattgccagaatctttaacacatacggaccaagaatgtgcattgatgatgggcgtgtggtcagtaacttc |
49756805 |
T |
|
| Q |
215 |
gttgctcaggtaaaca |
230 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49756806 |
gttgctcaggtaaaca |
49756821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 146 - 226
Target Start/End: Complemental strand, 39566097 - 39566017
Alignment:
| Q |
146 |
attgccagaatctttaacacatacggaccaagaatgtgcattgatgatgggcgtgtggtcagtaacttcgttgctcaggta |
226 |
Q |
| |
|
||||| || |||||||| ||||| ||||| ||||||||| | |||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
39566097 |
attgctaggatctttaatacatatggacccagaatgtgcttagatgatggacgtgtcgttagtaacttcgttgctcaggta |
39566017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 224
Target Start/End: Complemental strand, 41269257 - 41269179
Alignment:
| Q |
146 |
attgccagaatctttaacacatacggaccaagaatgtgcattgatgatgggcgtgtggtcagtaacttcgttgctcagg |
224 |
Q |
| |
|
|||||||||||||| |||||||| |||||| | ||| || |||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
41269257 |
attgccagaatcttcaacacatatggaccacgcatgaatatcgatgatgggcgtgtcgtcagcaactttattgctcagg |
41269179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University