View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_45 (Length: 245)
Name: NF11622_low_45
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 225
Target Start/End: Complemental strand, 35745628 - 35745393
Alignment:
| Q |
8 |
agtgagatgaataacattgaaagacaagacatgcagaagatgttggaagtctagcattacctatctatctgagatatcctaggcactattaattgatatt |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35745628 |
agtgacatgaataacattgaaagacaagacatgcagaagatgttggaagcttagcattacctatctatctgagatatcctaggcactattaattgatatt |
35745529 |
T |
|
| Q |
108 |
atataagcacttgcagggactgaaagtgataaaaggctctagcacacctaagaag------------------tcttcaaaggctcagagcaaagaaaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35745528 |
atataagcacttgcagggactgaaagtgataaaaggctctagcacacctaagaagtcttgcacacctaagaagtcttcaaaggctcagagcaaagaaaat |
35745429 |
T |
|
| Q |
190 |
ggagagtcaatggagttatcattcgtaggagcagac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35745428 |
ggagagtcaatggagttatcattcgtaggagcagac |
35745393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University