View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_48 (Length: 233)
Name: NF11622_low_48
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 7 - 212
Target Start/End: Complemental strand, 687737 - 687532
Alignment:
| Q |
7 |
taaaacaatgtataaaaaatttctaagcgctccctcaaaatcttgaatggaactgatatgaccatagttgttgaaagacgatagccgtatctaaggcagg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
687737 |
taaaacaatgtataaaaaatttctaagcgctccctcaaaatcttgaatggaactgatatgaccatagttgttgaaagacgatagccgtttctaaggcagg |
687638 |
T |
|
| Q |
107 |
gcaaaaggggcaaatatagtgggctctnnnnnnntaagtttaaaattggggcccctaaaattaaataaaaccttacacaaatgttaaggttgttttttct |
206 |
Q |
| |
|
|||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
687637 |
gcaaaaagggcaaatatactgggctctaaaaaaataagtttaaaattggggcccctaaaattaaataaaaccttacacaaatgttaaggttattttttct |
687538 |
T |
|
| Q |
207 |
cataag |
212 |
Q |
| |
|
|||||| |
|
|
| T |
687537 |
cataag |
687532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University