View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11622_low_49 (Length: 231)
Name: NF11622_low_49
Description: NF11622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11622_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 212
Target Start/End: Original strand, 684496 - 684699
Alignment:
| Q |
9 |
gagagagatgaaaggagaattgaaacgtgttgattgacgtcggagagaacggcgtcgagagcgtctccggtgagaggaagggagatctgtgtgtcttgtt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
684496 |
gagaaagatgaaaggagaattgaaacgtgttgatcgacgtcggagagaacggcgtcgagagcgtctccggtgagaggaagggagatctgtgtgacttgtt |
684595 |
T |
 |
| Q |
109 |
ggaattgttcttcttgttgttccagttttcttttctggcctttcttctctgatgatggtaaaagctccatcaacggttaagaagaataagaagaaagagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
684596 |
ggaattgttcttcttgttgttccagttttcttttctggcctttcttctctgatgatggtagaagctccatcaacggttaagaagaataagaagaaagagt |
684695 |
T |
 |
| Q |
209 |
ctag |
212 |
Q |
| |
|
|||| |
|
|
| T |
684696 |
ctag |
684699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University