View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11623_low_5 (Length: 387)
Name: NF11623_low_5
Description: NF11623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11623_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 17 - 374
Target Start/End: Complemental strand, 24514405 - 24514045
Alignment:
| Q |
17 |
acttaaaacggttttacattgatattcacgagaatccattattttggcacatcacttcattttcgaaattgatagtgtgacatagaaaattgacggcttc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24514405 |
acttaaaacggttttacattgatattcacgagaatccattatttttgcacatcacttcattttcgaaattgatagtgtgacatagaaaattgacgacttc |
24514306 |
T |
 |
| Q |
117 |
ttatcagaaatcggtataannnnnnnnn-acaatgctaatatatatgccatcaaattcttgaaaatacgatannnnnnn-agaagatttgccaattatat |
214 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
24514305 |
ttatcagaaatcggtgtaaatttttttttacaatgctaatatatatgctatcaaattcttgaaaatacgatattttttttataagatttgccaattatat |
24514206 |
T |
 |
| Q |
215 |
tactcgagttgtaacnnnnnnn-attttatttctgtgatgtgtcatagtaaatggcaagcattcaaattggcatctctttctggcttggctgagccccta |
313 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24514205 |
tactcgagttgtaacttttttttattttatttctgtgatgtgtcatagtaaatggcaagcattcaaattggcatctctttctggcttggctgagccccta |
24514106 |
T |
 |
| Q |
314 |
ggggttattattgtaggtaatatcctctgcttttgctgctttgtaccatattaacgcatct |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24514105 |
ggggttattattgtaggtaatatcctctgcttttgctgctttgtaccatattaacgcatct |
24514045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University