View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11624_high_10 (Length: 384)
Name: NF11624_high_10
Description: NF11624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11624_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 367
Target Start/End: Original strand, 45344170 - 45344535
Alignment:
| Q |
1 |
tggcagcttacaactttacctgaaggtgctaagaagattggtgtgaaatgggtctttagaaccaaattaaatgagaacggcgaggttgataagttcaaag |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45344170 |
tggcagcttacaaatttacctgaaggtgctaagaagattggtgtgaaatgggtctttagaaccaaattaaatgagaatggcgaggttgataagttcaaag |
45344269 |
T |
|
| Q |
101 |
ccaggttagtagctaaaggttatgctcagcaacaaaggattgattataacgaagtatttgctccggtagcaaggtgggacacaatccggatgattttagc |
200 |
Q |
| |
|
|| |||| ||||||||||| ||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45344270 |
cccggttggtagctaaaggctatgctcagcaacaaggg-ttgattataacgaagtctttgctccggtagcaaggtgggacacaatccggatggttttagc |
45344368 |
T |
|
| Q |
201 |
tttagcagcacaaaaggggtggagtgtgtatcaactcgatgtcaaaagcgcatttcttcatggtgagttaatagaggacgtgtatgtagaacaaccattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
45344369 |
tttagcagcacaaaaggggtggagtgtgtaccaactcgatgtcaaaagcgcatttcttcatagtaagttaatagaggacgtgtatgtagaacatccatta |
45344468 |
T |
|
| Q |
301 |
gggtatgtccgaaggggtgaagaagaaaaggtctacaagcttaagaaagctttatatgggttaaagc |
367 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45344469 |
gggtatgtccgaaggggtgaaaaagaaaaggtctacaagcttaagaaagctttatatgggttaaagc |
45344535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 61 - 129
Target Start/End: Complemental strand, 3013390 - 3013322
Alignment:
| Q |
61 |
accaaattaaatgagaacggcgaggttgataagttcaaagccaggttagtagctaaaggttatgctcag |
129 |
Q |
| |
|
|||||||| |||||||| || |||||||| || | |||||| || ||||||||||| || ||||||||| |
|
|
| T |
3013390 |
accaaattgaatgagaaaggagaggttgagaaatacaaagctagattagtagctaagggatatgctcag |
3013322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University