View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11624_high_11 (Length: 375)
Name: NF11624_high_11
Description: NF11624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11624_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 50 - 365
Target Start/End: Complemental strand, 7805919 - 7805604
Alignment:
| Q |
50 |
atgtggctgcaacttctaatgaggaaagtcaaccaaattcattttctagatgatgagaatggagtgatgtgtagatctgctgatgctattaacattgatc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7805919 |
atgtggctgcaacttctaatgaggaaagtcaaccaaattcattttctagatgatgagaatggagtgatgtgtagatctgctgatgctattaacattgctc |
7805820 |
T |
 |
| Q |
150 |
aatactactttgcagattttattccaaaagaagcgaagcatagctcgcatgatttggtcgtaaatgcaatgccaccttctataacaaatgatgacaatga |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7805819 |
aatactactttgcagattttattccaaaagaagcgaagcatagctcgcatgatttggtcgtaaatgcaatgccaccttctataacaaattatgacaatga |
7805720 |
T |
 |
| Q |
250 |
agttttgactgctcgtattcgttttgatgaattctatagagattgatgtgtccaaatccgggtttttatcaacactatatgtgtggtcatgaaatatttg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7805719 |
agttttgactgctcgtattcgttttgatgaattctatacaggttgatgtgtccaaatccgggtttttatcaacactctatgtgtggtcatgaaatatttg |
7805620 |
T |
 |
| Q |
350 |
taataggttgcctttg |
365 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7805619 |
taataggttgcctttg |
7805604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University