View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11624_high_18 (Length: 268)

Name: NF11624_high_18
Description: NF11624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11624_high_18
NF11624_high_18
[»] chr4 (1 HSPs)
chr4 (18-268)||(1217720-1217970)


Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 1217970 - 1217720
Alignment:
18 ggaatttggcatgagaacaaaagaggaagtgctgtctttgtataccccacttgtgcatgaggaattattggggtttcacgtgcacatattgagaaaagaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1217970 ggaatttggcatgagaacaaaagaggaagtgctgtctttgtataccccacttgtgcatgaggaattattggggtttcacgtgcacatattgagaaaagaa 1217871  T
118 aaacaagatgtcttgtgtttggattttggtgtaagtgggttttagagactttggatttttacatcatcttattggcctttcttaatccctcttagatatc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
1217870 aaacaagatgtcttgtgtttggattttggtgtaagtgggttttagagactttggatttttacatcatcttattggcctttcttaagccctcttagatatc 1217771  T
218 aatgaataggactcaactacccttcaaatgtcacaactttccttgtcccat 268  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||    
1217770 aatgaataagactcaactacccttcaaatgtcacaactttccttgtcccat 1217720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University