View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11624_high_21 (Length: 253)
Name: NF11624_high_21
Description: NF11624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11624_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 46404385 - 46404143
Alignment:
| Q |
1 |
catcttcccccatattattctttaaaagttactagaggtaattagttgtgtatcttgtgtagcaaatgaaaaatcatatgattttttatgtactgcaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46404385 |
catcttcccccatattattctttaaaagttactagatgtaattagttgtgtatcttgtgtagcaaatgaaaaatcatatgattttttatgtactgcaaat |
46404286 |
T |
|
| Q |
101 |
gtttaacaatataatttcaaacgtgcttcaggagaaaatgagtcgccggtcgagtcgaacaatatatgtcggcaatcttcctggtgacattcgtttgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46404285 |
gtttaacaatataatttcaaacgtgcttcaggagaaaatgagtcgccggtcgagtcgaacaatatatgtcggcaatcttcctggtgacattcgtttgaga |
46404186 |
T |
|
| Q |
201 |
gaagtagaggatcttttctacaaagttcgtatgcgtatctctg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46404185 |
gaagtagaggatcttttctacaaagttcgtatgcgtatctctg |
46404143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 223
Target Start/End: Complemental strand, 37123445 - 37123357
Alignment:
| Q |
135 |
aaaatgagtcgccggtcgagtcgaacaatatatgtcggcaatcttcctggtgacattcgtttgagagaagtagaggatcttttctacaa |
223 |
Q |
| |
|
||||||||| ||||||| ||||| ||| ||||||| ||||||||||||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
37123445 |
aaaatgagtggccggtcaagtcgcacattatatgttggcaatcttcctggtgatattcgcctgagagaagttgaggatcttttctacaa |
37123357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University