View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11624_high_23 (Length: 250)
Name: NF11624_high_23
Description: NF11624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11624_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 46 - 238
Target Start/End: Complemental strand, 1217098 - 1216906
Alignment:
| Q |
46 |
tagcttctatgatcttatttacaataaaacttaaaaatcataagtgtcactaacatggtatgtgacacaaatggtagatagctgagtatgtcaattattt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1217098 |
tagcttctatgatcttatttacaataaaacttaaaaatcataagtgtcactaacatggtatgtgacacaaatggtagatagctgagtatgtcaattattt |
1216999 |
T |
|
| Q |
146 |
ggtcaaatgttcaactatggatagtcgatcatttaaacaactctgagttatctcgagaaattagtttatgcaattacatgtgattgatgcctt |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1216998 |
ggtcaaatgttcaactatggataatcgatcatttaaacaactctaggttatctcgagaaattagtttatgcaattacatgtgattgatgcctt |
1216906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 1217499 - 1217439
Alignment:
| Q |
1 |
cccattattgactgttagatgaagatgatcagacaatttgtattttagcttctatgatctt |
61 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1217499 |
cccatcattgactgttagatgaagatgatcagacaatttgtattttagcttctatgatctt |
1217439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University