View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11624_low_15 (Length: 333)
Name: NF11624_low_15
Description: NF11624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11624_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 317
Target Start/End: Complemental strand, 28643548 - 28643511
Alignment:
| Q |
280 |
ccacaataaagatgattatgtccacctagcaaatggtg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28643548 |
ccacaataaagatgattatgtccacctagcaaatggtg |
28643511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 21402432 - 21402387
Alignment:
| Q |
16 |
aaaggggaatttttaattgttgttgatgatgatggttcatgtgtaa |
61 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21402432 |
aaaggggaatttttaattgttgttgagaatgatggttcatgtgtaa |
21402387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 317
Target Start/End: Complemental strand, 20884814 - 20884699
Alignment:
| Q |
201 |
cttcccatatccattctctattt----tttcaactttttaggctgtgtgtgttaaaattaaaattttatgctacaattagaacccacaataaagatgatt |
296 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| | || | ||||||||| |||| || ||||||| ||||||||||| ||| ||||||||| |
|
|
| T |
20884814 |
cttccaatatccattctctatttattttttcaactttatgggttttgtgtgttagaattggaa----atgctacgattagaaccca-aatgaagatgatt |
20884720 |
T |
 |
| Q |
297 |
atgtccacctagcaaatggtg |
317 |
Q |
| |
|
|||||| ||||||||| |||| |
|
|
| T |
20884719 |
atgtccgcctagcaaagggtg |
20884699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University