View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11624_low_6 (Length: 436)
Name: NF11624_low_6
Description: NF11624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11624_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 155 - 352
Target Start/End: Complemental strand, 42217816 - 42217619
Alignment:
| Q |
155 |
gaatggaatggaacaagcattattgggattctttttggggtaacataataagatccatgtacggattttttaggtgtactaacccacactataaacgttt |
254 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217816 |
gaatggaacggaacaagcattattgggattttttttggggtaacataataagatccatgtacggattttttaggtgtactaacccacactataaacgttt |
42217717 |
T |
 |
| Q |
255 |
ttaaaataacaaaagtcatctcaatgatgtatatgactatatttatctatgannnnnnnnagggtaacatgcaagagagtatctagttgtggggtaag |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42217716 |
ttaaaataacaaaagtcatctcaatgatgtatatgactatatttatctatgagtttttttagggtaaattgcaagagagtatctagttgtggggtaag |
42217619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 42217957 - 42217848
Alignment:
| Q |
1 |
tcgacgtcagaggactattgtaatgactgaaatacccttttggttgttgaacaaatgtgctgtggggtctaattagatccaatgctttttgtctttttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217957 |
tcgacgtcagaggactattgtaatgactgaaatacccttttggttgttgaacaattgtgctgtggggtctaattagatccaatgctttttgtctttttct |
42217858 |
T |
 |
| Q |
101 |
tttgggaaaa |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
42217857 |
tttgggaaaa |
42217848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University