View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_high_37 (Length: 288)
Name: NF11625_high_37
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_high_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 31699022 - 31699299
Alignment:
| Q |
1 |
gatgttcttaaatccttgttatgaggtatggtaggaacttattaagtgtggcatggggaatataattagattgcagatgaacggagtctgttgataggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31699022 |
gatgttcttaaatccttgttatgaggtagggtaggaacttattaagtgtggcatggggaatataattagattgctgatgaacggagtctgttgataggta |
31699121 |
T |
|
| Q |
101 |
tacagcaatgtaaaaactgaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttatactatttgtcgatttatattc |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
31699122 |
tacagcaatgcaaaaactgaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttatactatttgtcaatttattttc |
31699221 |
T |
|
| Q |
201 |
aaccaaaccattttggttagatgtgctagtcaatctatggatgatgccaaatttattgagaaattgtgcacaggttct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699222 |
aaccaaaccattttggttagatgtgctagtcaatctatggatgatgccaaatttattgagaaattgtgcacaggttct |
31699299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University