View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_high_43 (Length: 264)
Name: NF11625_high_43
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_high_43 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 46967162 - 46966917
Alignment:
| Q |
19 |
aatggagttgacaggaatgaaatgacattgccttgagattctatcgaaggcagttctatttatgtttgcaggtgattggtttcactggttcactaatcac |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46967162 |
aatggagttgaaaggaatgaaatgacattgccttgagattctatcgaaggcagttctatttatgtttgcaggcgattggtttcactggttcactaatcac |
46967063 |
T |
 |
| Q |
119 |
acaatatactaccaatagtagctccgttatgttaaggctacccccgaatacgaatactggagaaattatatttttggatttgttagacataattcaaaca |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46967062 |
acaatatactaccaatagtaactccgttatgttaaggctacccccgaatacgaatactggagaaattatatttttggatttgttagacataattcaaaca |
46966963 |
T |
 |
| Q |
219 |
atgtaattataattttacattgttatattctactgtatcttgtttt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46966962 |
atgtaattataattttacattgttatattctactgtattttgtttt |
46966917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University