View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11625_high_46 (Length: 253)

Name: NF11625_high_46
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11625_high_46
NF11625_high_46
[»] chr8 (2 HSPs)
chr8 (1-100)||(5754603-5754702)
chr8 (168-239)||(5754762-5754833)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 5754603 - 5754702
Alignment:
1 tattaaccatctgaactcaaccacttagataatgaattggctcaattaggctctcaagttcggagtaacattcctctgaaaaaagtagataagagtaaca 100  Q
    ||||||||||||||||| |||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||| | |||| |||||||||||||||||    
5754603 tattaaccatctgaacttaaccgcttagatgatgaattggctcaatcaggctctcaagttcggagtaacattcctttaaaaatagtagataagagtaaca 5754702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 168 - 239
Target Start/End: Original strand, 5754762 - 5754833
Alignment:
168 acatatatgcacactagtgttgaagtaccttttatactttaaacgcccacaaaaattgtcatattatttcat 239  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
5754762 acatatatgcacactagtgttgaagtaccttttatactttaaatgcccacaaaaattgtcatattatttcat 5754833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University