View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_high_49 (Length: 248)
Name: NF11625_high_49
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 238
Target Start/End: Original strand, 28667987 - 28668220
Alignment:
| Q |
5 |
cagaaggctcaaaccaaaatttggtgggaacgtgaaaatcctctcggagttgggtcatctttggattttccaaaaccagttgttgcttttgaaattgcgg |
104 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| | |
|
|
| T |
28667987 |
cagaaggcgcaaaccaaaatttggtgggaacgtgaaaatcctctcggagttgggtcatctttggctttttcaaaaccagttgttgcttttgaaattgcag |
28668086 |
T |
 |
| Q |
105 |
tgtctgatacgagaatagagcatcctgaacagcaagcttcaccttatattattgctctcgttgaaactgattttttccagaccgtagagcacccagcaga |
204 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
28668087 |
tgtctgatacgacaatagagcatcctgaacaacaagcttcaccttctattattgctcccgttgaaactgattttttctagaccgtagagcacccaacaga |
28668186 |
T |
 |
| Q |
205 |
aacacctcttgatggcggtaacaactcttttcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28668187 |
aacacctcttgatggcggtaacaactcttttcat |
28668220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University