View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_high_56 (Length: 222)
Name: NF11625_high_56
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_high_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 13179502 - 13179572
Alignment:
| Q |
1 |
agatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaattata |
71 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13179502 |
agatgacactgtttatgttgctgtcaaatcggtaatgcattttgttggaactgtttttgcaattaattata |
13179572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 32373747 - 32373680
Alignment:
| Q |
1 |
agatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaatt |
68 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373747 |
agatgacactgtttatgatgctgtgaaatcggtaatgcattttgttggaactgtttttgcaattaatt |
32373680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 32409783 - 32409716
Alignment:
| Q |
1 |
agatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaatt |
68 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32409783 |
agatgacactgtttatgatgctgtcaaatcggtaatgcattttgttggaactggttttgcaattaatt |
32409716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 195
Target Start/End: Complemental strand, 1424132 - 1424060
Alignment:
| Q |
126 |
aaaatattatatatgactagtatcatc---attgatattttatattgtatgatcctacgcatgatggacttct |
195 |
Q |
| |
|
||||||||||||||||||| ||| ||| | ||||||||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
1424132 |
aaaatattatatatgactaatatgatcggcactgatattttatgttgtaagatcctatgcatgatggacttct |
1424060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University