View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_high_57 (Length: 218)
Name: NF11625_high_57
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_high_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 52 - 199
Target Start/End: Complemental strand, 39023172 - 39023006
Alignment:
| Q |
52 |
taaatgcatgtatatctatcaaattgtttttgttatgcgatctccaaatagtaaatgttccctctctt-------------------actattatcacaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39023172 |
taaatgcatgtatatctatcaaattgtttttgttatgcgatctccaaatagtaaatgttccctctcttcctagagcatctatctcttactattatcacaa |
39023073 |
T |
 |
| Q |
133 |
tatttttcattacatcttatattgcatttctttcatttttataaataaaatgctaaaaactcaacag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39023072 |
tatttttcattacatcttatattgcatttctttcatttttataaataaaatgctaaaaactcaacag |
39023006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 39023376 - 39023309
Alignment:
| Q |
1 |
gatgtgtttaatgttaagtttaagttaaaattatacagtatggatttttagtaaatgcatgtatatct |
68 |
Q |
| |
|
|||||| | |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39023376 |
gatgtgctaaatgttaattttaagttaaaattataccttatggatttttagtaaatgcatgtatatct |
39023309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University