View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_high_58 (Length: 215)
Name: NF11625_high_58
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_high_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 84 - 199
Target Start/End: Complemental strand, 24806575 - 24806461
Alignment:
| Q |
84 |
aaaaaggggttgataatgttgagaaataagttgctggaaaatcaactaatagggatgttattgctaacaaattgagttgttggaaagaaaaagaaaaata |
183 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
24806575 |
aaaaaggggttgcaaatgttgagaaatacgttgctggaaaatcaattaatagggatgttattgctaacaaattgagttattggaaagaaaaa-aaaaata |
24806477 |
T |
|
| Q |
184 |
gagtttatgtttcaat |
199 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24806476 |
gagtttatgtttcaat |
24806461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 34 - 102
Target Start/End: Original strand, 32403326 - 32403394
Alignment:
| Q |
34 |
gatggatttgaattatgagattaagaaaaagcatgccactatgtctcacaaaaaaggggttgataatgt |
102 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
32403326 |
gatggatttgaataatgagaataagaaaaatcatgccactatatatcacaaaaaaggggttgttaatgt |
32403394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University