View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_high_61 (Length: 212)
Name: NF11625_high_61
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_high_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 31756189 - 31756019
Alignment:
| Q |
1 |
ctgaatctattcttcctttgtctcggattcttccggggccttgtgttcaatcttcttgtagtgagtgtggtatatatcctgattcacaatcattatgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31756189 |
ctgaatctattcttcctttgtctcggattcttccggggccttgtgttcaatcttcttgtagtgagtgtggtatatatcctgattcacaatcattatgttc |
31756090 |
T |
|
| Q |
101 |
taactttggtcacatttgcaagccaaatatatgtaacactcaaataacaagcccgccgccgcctccaccag |
171 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31756089 |
taactttggtcacatttgcaacccaaatatatgtaacactcaaataacaagcccgccgccgcctccaccag |
31756019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 80
Target Start/End: Complemental strand, 35559376 - 35559337
Alignment:
| Q |
41 |
ttgtgttcaatcttcttgtagtgagtgtggtatatatcct |
80 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
35559376 |
ttgtgttcaatcttcttgtagtgaatgtggtatgtatcct |
35559337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University