View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_21 (Length: 417)
Name: NF11625_low_21
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 11 - 402
Target Start/End: Original strand, 40568419 - 40568809
Alignment:
| Q |
11 |
catagggggaggggagggaacacatactt----tgatgataaggttatatcagaattgtgcaaaccttgcaatgatgctatcatcatcataatacttcta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
40568419 |
catagggggaggggagggaacacatacttaatttgatgataaggttatatcagaattgtgcaaaccttgcaatgatgctatgatcat---aatatttcta |
40568515 |
T |
 |
| Q |
107 |
ggtaaattcattggttatgttacgacgagggagcatgtcaaggcgttatggaaactaactggtggttttgagattgtagatattggccatggatttttca |
206 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40568516 |
ggtaaattcattggttatgttacgacg--ggagcatgtcaaggcgttatggaaactaactggtggttttgagattgtagatattggccatggatttttca |
40568613 |
T |
 |
| Q |
207 |
tggtacagttcgatatagaggctgataaagaaaaagtgcttgaaggggggacttattttcaagctggcaccaataataacacggcacaaaaaatacggac |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40568614 |
tggtacagttcgatatagaggctgataaagaaaaagtgcttgaaggggggacttattttcaagctggcaccaataataacacggcacaaaaaatatggac |
40568713 |
T |
 |
| Q |
307 |
aagaaacatccaaggagtgatattaacggtacaaattataagccacaagtagagacatacactaacatgggacatgtgataactagccaaaaatgt |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40568714 |
aagaaacatccaaggagtgatattaacggtacaaattataagccacaagtagagacatacactaacatgggacatgtgataactagccaaaaatgt |
40568809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University