View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_27 (Length: 366)
Name: NF11625_low_27
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 20 - 259
Target Start/End: Complemental strand, 1361379 - 1361140
Alignment:
| Q |
20 |
gattaacataaaatgtgataatcaattgagtagaactagaacttgtctaaaagatttgctaataattgttgagaagagttttatccataaggttactcat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1361379 |
gattaacataaaatgtgataatcaattgagtagaactagaactagtctaaaagatttgctaataattgttgagaagagttttatccataaggttactcat |
1361280 |
T |
|
| Q |
120 |
ccctgtgattgtcacaatctctaagaatttcttttattctctcttcgcgagtacaatttaatctgcgcgcaaattcttccacttctttgtcagtcattaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1361279 |
ccctgtgattgtcacaatctctaagaatttcttttattctctcttcgcgagtacaatttaatctgcgcgcaaattcttccacttctttgtcagtcattaa |
1361180 |
T |
|
| Q |
220 |
gtcatgatcaatctcatcatcaaactcaactacaggaccc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1361179 |
gtcatgatcaatctcatcatcaaactcaaccacaggaccc |
1361140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 118 - 249
Target Start/End: Complemental strand, 1350707 - 1350576
Alignment:
| Q |
118 |
atccctgtgattgtcacaatctctaagaatttcttttattctctcttcgcgagtacaatttaatctgcgcgcaaattcttccacttctttgtcagtcatt |
217 |
Q |
| |
|
||||| ||||||||||| |||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
1350707 |
atcccggtgattgtcacgatctctaagagtttcttttattctctcttccaaagtgcaatttaatctgcgcgcaaattcttccacttctctgtcggtcatt |
1350608 |
T |
|
| Q |
218 |
aagtcatgatcaatctcatcatcaaactcaac |
249 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
1350607 |
gggtcctgatcaatctcatcatcaaactcaac |
1350576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 204
Target Start/End: Complemental strand, 1344176 - 1344091
Alignment:
| Q |
119 |
tccctgtgattgtcacaatctctaagaatttcttttattctctcttcgcgagtacaatttaatctgcgcgcaaattcttccacttc |
204 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| |||||||||| | || ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
1344176 |
tccctgtgattgccagcatctctaagaatttctttttttctctcttcccaagaacaatttaatctgcgtgcaaattcttcgacttc |
1344091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 204
Target Start/End: Original strand, 1355411 - 1355496
Alignment:
| Q |
119 |
tccctgtgattgtcacaatctctaagaatttcttttattctctcttcgcgagtacaatttaatctgcgcgcaaattcttccacttc |
204 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| |||||||||| | || ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
1355411 |
tccctgtgattgccagcatctctaagaatttctttttttctctcttcccaagaacaatttaatctgcgtgcaaattcttcgacttc |
1355496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 81 - 119
Target Start/End: Complemental strand, 1350805 - 1350767
Alignment:
| Q |
81 |
ataattgttgagaagagttttatccataaggttactcat |
119 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
1350805 |
ataattgttgagaagagttttgttcataaggttactcat |
1350767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 138 - 204
Target Start/End: Complemental strand, 24618545 - 24618479
Alignment:
| Q |
138 |
ctctaagaatttcttttattctctcttcgcgagtacaatttaatctgcgcgcaaattcttccacttc |
204 |
Q |
| |
|
|||||||||||||| || | |||||||| | || ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
24618545 |
ctctaagaatttctattttcctctcttcccaagcacagtttaatctgcgtgcaaattcttccacttc |
24618479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 204
Target Start/End: Original strand, 43364464 - 43364496
Alignment:
| Q |
172 |
acaatttaatctgcgcgcaaattcttccacttc |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
43364464 |
acaatttaatctgcgggcaaattcttccacttc |
43364496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University