View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_28 (Length: 366)
Name: NF11625_low_28
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 296
Target Start/End: Original strand, 54958171 - 54958453
Alignment:
| Q |
17 |
acgtgaaaggtgttgaggatagggataaggatgatactctgaagatgttgctagaagccaagacaaatgatgcacaagaaccattagctattgcagctga |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
54958171 |
acgtgaaaggtgttgaggatagggacaaggatgatactctgaagatgttgctagaagccaagacaagtgatgcacaagaaccattagcaattgctgctga |
54958270 |
T |
 |
| Q |
117 |
tattggatatgatgagaattgcaaacaggttgtggaacttgttgtcaaagagtatgga---cgcattgatgttcttgtcaacaatgcagctgaacaacac |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54958271 |
tattggatatgatgagaattgtaaacaggttgtggaacttgttgtaaaagaatatggaagcagcattgatgttcttgtcaacaatgcagctgaacaacac |
54958370 |
T |
 |
| Q |
214 |
ctcaaaaactcaatagaggaaatcactgaacaacagcttgaaagagttttcaggaccaacatcttttcacacttcttcttggt |
296 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54958371 |
ctcagaaactcaatagaggaaatcactgaacaacagcttgaaagagttttcaggaccaacatcttttcacacttcttcttggt |
54958453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University