View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_31 (Length: 349)
Name: NF11625_low_31
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 4 - 325
Target Start/End: Original strand, 54958602 - 54958923
Alignment:
| Q |
4 |
aaactcaacctcagtgaatgcctacgcaggtaaagcaggaacactcgactacacatcgacgaaaggagccattgttgcattcactagaggtcttgctcag |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54958602 |
aaactcaacctcagtgaatgcctacacaggtaaagcagaaacactcgactacacatcgacgaaaggagccattgttgcattcactagaggtcttgctcag |
54958701 |
T |
|
| Q |
104 |
cagttggtgagaaagggaataagagtgaatggtgttgcaccaggaccaatttggacgccagttcaaccagctactatgacttatgagaagatacagaatt |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54958702 |
cagttggtgagcaagggaataagagtgaatgctgttgctccaggaccaatttggacgccagttcaaccagctactatgccttatgagaagatacagaatt |
54958801 |
T |
|
| Q |
204 |
tggggtcagatgtgccaatgaaacgagcaggtcagccttgtgagattgcaccttgttatttgttcttggcttctcttcaggactcttcttactttactgg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54958802 |
tggggtcagatgtgccaatgaaacgagcaggtcagccttgtgagattgcaccttgttatttattcttggcttctctacaggactcttcttactttactgg |
54958901 |
T |
|
| Q |
304 |
tcaagtcctccatccaaatggt |
325 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
54958902 |
tcaagtcctccatccaaatggt |
54958923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University