View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_42 (Length: 285)
Name: NF11625_low_42
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 19 - 153
Target Start/End: Original strand, 12814183 - 12814316
Alignment:
| Q |
19 |
tcatcactttgttttccactcttaagtatataccaccaattattttgcatatgtaacactgtaggaaaagaatcaagatgatgttttggaaatagttttt |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12814183 |
tcatcactttgttttccactct-aagtatatatcaccaattactttgcatatgtaacattgtaggaaaaaaatcaagatgatgttttggaaatagttttt |
12814281 |
T |
 |
| Q |
119 |
cttgcatataaatgatgtgtttagcagtagaaatg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12814282 |
cttgcatataaatgatgtgtttagcagtagaaatg |
12814316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 12814373 - 12814438
Alignment:
| Q |
210 |
gtaatgataatttcttttgtgtattctcttttcactttctcttattagttaaagtattatattcat |
275 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12814373 |
gtaatgataatttcttatgtgtattctcttttgactttctcttattagttaaagtattatattcat |
12814438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University