View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_43 (Length: 273)
Name: NF11625_low_43
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 28 - 255
Target Start/End: Complemental strand, 2330201 - 2329974
Alignment:
| Q |
28 |
aactatgaatgaaaataactattcggatttctagaattaattctcaacagaaaattgaaacagttttgtttagcttgaataggtatgaggttggtggtag |
127 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2330201 |
aactatgaatgaaaataactatttggatttctacaaataattctcaacagacaattgaaacagttttgtttagcttgaataggtatgaggacggtggtag |
2330102 |
T |
 |
| Q |
128 |
ctttttaattacctgatttggaaaatagcatgcagaagaaaaagatgaaaagcacagtgattattgttgcaagtttgagtccatgtagatgataggatct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2330101 |
ctttttaattacctgatttggaaaatagcatgcagaagaaaaagatgaaaagcacagtgattattgttgcaagtttgagtccatgtagatgataggatct |
2330002 |
T |
 |
| Q |
228 |
agcaggtggagccatcaatgagagaatt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2330001 |
agcaggtggagccatcaatgagagaatt |
2329974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University