View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_44 (Length: 270)
Name: NF11625_low_44
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 99 - 228
Target Start/End: Complemental strand, 54660603 - 54660479
Alignment:
| Q |
99 |
ggaatttttagtcgattaagatacaaaagcagaaacatacataattaaaacaacaca--aatctcatgtctaaaaacaagaattattacagaggggaaga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| | || ||||||||||||||||| || ||| |
|
|
| T |
54660603 |
ggaatttttagtcgattaagatacaaaagcagaaacatacataattaaaacaacacatgaagctcct-cct--aaacaagaattattacaaag----aga |
54660511 |
T |
|
| Q |
197 |
agaatgagacataacataagtaaattaaacaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54660510 |
agaatgagacataacataagtaaattaaacaa |
54660479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University