View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_50 (Length: 253)
Name: NF11625_low_50
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 5754603 - 5754702
Alignment:
| Q |
1 |
tattaaccatctgaactcaaccacttagataatgaattggctcaattaggctctcaagttcggagtaacattcctctgaaaaaagtagataagagtaaca |
100 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
5754603 |
tattaaccatctgaacttaaccgcttagatgatgaattggctcaatcaggctctcaagttcggagtaacattcctttaaaaatagtagataagagtaaca |
5754702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 168 - 239
Target Start/End: Original strand, 5754762 - 5754833
Alignment:
| Q |
168 |
acatatatgcacactagtgttgaagtaccttttatactttaaacgcccacaaaaattgtcatattatttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5754762 |
acatatatgcacactagtgttgaagtaccttttatactttaaatgcccacaaaaattgtcatattatttcat |
5754833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University