View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11625_low_53 (Length: 251)
Name: NF11625_low_53
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11625_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 186
Target Start/End: Complemental strand, 1424390 - 1424227
Alignment:
| Q |
23 |
gatgaacagtggcgtactacggaaagtgcactcggaatgaacagtacttgcgataaacagtttgcatggtgaatagtgttttctaatgaacagggctttt |
122 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1424390 |
gatgaacagtggcgcactatggaaagtgcactcgaaatgaacagtacttgcgataaacagtgtgcatggtgaatagtgttttctaatgaacagggctttt |
1424291 |
T |
|
| Q |
123 |
aggatctcaaagagtccgcgatgaaggcaaaaactcacaataaagacgaaaaaagcaaaagtaa |
186 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1424290 |
aggatctcaaagagtccgcgatgaacgcataaactcacaataaagacgaaaaaagcaaaagtaa |
1424227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University